Concept 30 Higher cells incorporate an ancient chromosome.

HI! Mitochondria have their own set of DNA. Since mitochondria are inherited from the egg, all of Queen Victoria's descendants, for example, inherited her mitochondrial (mt) DNA. Scientists were able to use this fact to solve the mystery of the Romanovs, the Russian royal family. The Romanovs were murdered in 1918 by the Bolshevik soldiers of the Russian revolution. In 1991, the remains of nine skeletons were exhumed from a mass grave in Siberia, Russia. These were believed to be the remains of the Romanovs and their servants. Since there were seven Romanovs and four servants, if this were the true burial site of the Romanovs, then two bodies were missing from the mass grave. Forensic scientists began the messy job of trying to identify the bodies, and proving that this was the Romanov party. First, they looked at the bones and assigned sex and general age to the skeletons. There were four male skeletons and five female skeletons. Three of the female skeletons were classified as children. Scientists isolated mitochondrial DNA from the bones and looked at a specific region of mtDNA, called the control region. This region has a high mutation rate, and related people share the same set of mutations. Let's look at the mtDNA sequences of just the females. 1. ACCCCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGTACATAGTAC 2. ACCCCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGTACATAGTAC 3. ACCCCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGTACATAGTAC 4. ACCCCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGTACATAGTAC 5. ACCTCTCACCCACTAGGATATCAACAAACCTACCCGCCCTTAACAGTACATAGCAC This screen shows only 56 nucleotides from the mtDNA control region. How many nucleotide differences are there? One. (No, there is more than one variable region.) Two. (No, there is more than one variable region.) Three. (No, there is more than one variable region.) Four. (That is correct.) When the sequences were aligned, there were four nucleotide differences in this segment of mtDNA. What does this tell us about the relationship among the females? Nothing, these females are not related. (No, we can’t say that for sure.) There is not enough evidence to conclude anything. (No, we can make a conclusion.) One of the females is not related to the others. (That is correct.) With few exceptions, people of the same maternal lineage have the same mtDNA sequence. Sample #5 must be the adult female servant. Since Sample #4 is the only other adult female, she must be the Tsarina Alexandria. Even though we know that these females are related, and there is documentary evidence that these are the Romanovs, how can we prove it? There is no way to prove it. (No, there is a way to figure it out.) Compare the mtDNA to that of a known female relative. (Yes, but the female relative must be from the maternal line.) Compare the mtDNA to that of a known male relative. (Yes, but the male relative must be from the maternal line.) None of the above. (That is correct.) The "Romanov" mtDNA can be compared with any male or female relative. Since mtDNA is maternally inherited, the only criterion is that the relative must be from the maternal side of the family. The current Duke of Edinburgh is a direct descendant of Queen Victoria, as was the Tsarina Alexandra. If you compare his mtDNA with the Romanov women, you can see it matches perfectly. The females in the grave were related to the Duke, and thus are likely to be the Romanovs. With just the mtDNA sequences, it is impossible to figure out which three of the Tsarina’s four daughters were buried in the mass grave. One of the Bolshevik guards that participated in the killing admitted that he had burned two of the bodies, that of Alexis and Anastasia. For those of you who know the story, Anna Andersen had always claimed that she escaped the mass killings and that she was Anastasia. Since there is a body missing from the grave, could she have been telling the truth all this time? This is Anna Andersen’s mtDNA sequence. Is she related to the Romanov family? Anna Andersen is Anastasia. (No, Anna Andersen’s mtDNA does not match the others.) Anna Andersen is not Anastasia. (That is correct.) It is impossible to tell. (No, there is enough information to draw a conclusion.) Anna Andersen’s mtDNA does not match those of the Romonov females. There are two nucleotide differences. So, Anna Andersen could not have been Anastasia. What about the male skeletons from the grave? Using similar comparison techniques with mtDNA from the male skeletons and from the Tsar’s closest maternal relative, which of the adult male skeletons is likely to be the remains of Tsar Nicholas? 1. CCCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGCACATAGTACAT 2. CCCTTACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGTACATAGTACAT 3. CCCTCACCCACTAGGATACCAACAAACCTACCCATCTTTAACAGTACATAGTACAT 4 .CCCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGTACATAGCACAT 5. CCCTCACCCACTAGGATACCAACAAACCTACCCATCTTTAACAGTACATAGTACAT Adult male# 1 (No, the sequence does not match that of the Tsar’s relative.) Adult male# 3 (That is correct.) Adult male# 2 (No, the sequence does not match that of the Tsar’s relative.) Adult male# 4 (No, the sequence does not match that of the Tsar’s relative.) None of the above. (No, one of the sequences does match.) The mtDNA from #3 matches that of Tsar Nicholas’ maternal relative. Sample #3 is very likely DNA from the mortal remains of Tsar Nicholas. The Russian government believed these to be the remains of the Romanovs and in 1998 reburied the remains in Saints Peter and Paul Cathedral in St. Petersburg, the traditional resting place of the Romanovs. CONGRATULATIONS! YOU'RE SO SMART!